Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10502E1
Clone ID IST10502E1
Vector VICTR76
Project tigm

Sequence tag IST10502E1HMF1
Sequence
AGATGAAAACTATGCNNTACGCAAGGTATGATATGCATACAGCATANTCTATAGTATGCCATACAACAGGCTGAAATGAC
GCCTGGGATGGTAAGGAAAATGCTGAAGGAAGGTAAAGAGCACTTAGCACAGGATGGATAGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI13516

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104619737..104619882 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002227 (Mov10) NM_008619 Moloney leukemia virus 10 Gene [Source:MGI (curated);Acc:Mov10-002]

 
Come back to gene ENSMUSG00000002227


For any suggestions or comments, please send an email to unitrap@crg.es