Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14948G8
Clone ID IST14948G8
Vector VICTR76
Project tigm

Sequence tag IST14948G8HMF1
Sequence
CCTGAAAGCCTCGTTCACACAAAAGCCCGTGGTAGGCAGATAGGCTGAGAACAACCTCAGCAGCAGAAGGGATGAGCACA
CAGGACCCCAGCTGAGCCTCTAGTGCAATATGGAAACCAGACTCAGCAGCTCCGCGGAGCAGTTACCAGGCACGCTGACT
CAGGGCTGGTCTGGAGATGGACCGGCAAGGAGTGGTTCATAGAACTCTGAAGTGATGTGTATGGGGGTGGGGTACCCACG
AGGGTGCTGGACCTCCTGGAGCTGGAGTTTACAGTTTGAACANCCTGACTCAGGTGCTGGGAACCAAACTTTGTAAGCAG
TACACATTCTAACTGTGGAGCCATCTTGCCNNCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 13194961..13195310 348
 
EST/CDNA Est Name
  AI036168.1 - AW744229.1 - BM506951.1 - BY050156.1 - BY043128.1 - BY054928.1 - BY058992.1 - BY037482.1 - BY052976.1 - BY287449.1 - BY038377.1 - BY058115.1 - BY092238.1 - BY100225.1 - BE860663.1 - BY103477.1 - AW744069.1


Sequence tag IST14948G8BBF1
Sequence
CCTGAAAGCCTCGTTCACACAAAAGCCCGTGGTAGGCAGATAGGCTGAGAACAACCTCAGCAGCAGAAGGGATGAGCACA
CAGGACCCCAGCTGAGCCTCTAGTGCAATATGGAAACCAGACTCAGCAGCTCCGCGGAGCAGTTACCAGGCACGCTGACT
CAGGGCTGGTCTGGAGATGGACCGGCAAGGAGTGGTTCATAGAACTCTGAAGTGATGTGTATGGGGGTGGGGTACCCNCN
ACGGTGCTGNNNCNNNTGNNNCTGNAGTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14948G8HMR1
Sequence
CAGGTTTTCTTTGTGGGATTGCCAGGTTATACTAAAGGCTTAGCTGGTAAGACATGGCATTGTCTANCCTGCGAAAGGCC
TANAATCGGATTCCCAGAATCAAAGGGGAAGGGGAGAGGAGCCAGAAAAGAAACTGCAAAGCGGTTTCTCCAAAGTGGCT
GCATTTTTGCATTCCCAGCACGCCTGAGGGCCCAGTGGCTGCANATTTTACATTGTTGATC
Sequence Type genomic DNA
Unitrap ID UNI18589

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 13194745..13194964 214
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038515 (Grtp1) NM_025768 GH regulated TBC protein 1 Gene [Source:MGI Symbol;Acc:MGI:1914040]

 
Come back to gene ENSMUSG00000038515


For any suggestions or comments, please send an email to unitrap@crg.es