Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12824H7
Clone ID IST12824H7
Vector VICTR76
Project tigm

Sequence tag IST12824H7HMF2
Sequence
GTATCTCCAGCTGATCTTGAACTTGTGATCCTCTCGTTTCATTTGTCCATGTGCTGGTATTACTTGTGTGTGGCAACACT
TCTGGCTCCTATTGTTTTCTTATAAAAGAAATGAACTTTGACTTTTACCACAAAGACAGCTGTTTGAAGGACAGGTGCAG
TTTCTAANAGTGTGTGGGGAAGTGGGTGGGGGAAGGCAAGATGGTANTTTCCCTCTGTAATCCAGANAACTTGGTCNATA
AACACTTCCCATAGGAAAGGANAAAGAACAGAAAAGCTATGCCTCAAAACAGCATTGTAAAGTTCACCTTTATATTACTT
GTTATAATTGNANTTCTTATCACATGATCNTTATTTCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 35987226..35987585 344
 
EST/CDNA Est Name
  CB234652.1 - CD772113.1 - BQ265808.1 - CB231667.1 - AA967249.1 - CK618224.1 - AA763015.1 - AA423726.1 - BY228036.1 - BI790820.1 - BG970839.1 - BY017284.1 - BG062437.2 - CB232161.1 - CB234255.1 - CB234272.1 - BF121450.1 - BY232295.1 - BE311134.1 - AW763414


Sequence tag IST12824H7BBF1
Sequence
GATCTTACCAAAGTAAAATAACCTAGTATTTATATAACATTATTTGTAAGCTTTTGTGAATTACCATGTTAGAAAATAAA
ACTAGANTNTNNATGCCTCTTTTAGTGTAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI35389

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52904135..52904248 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035247 (Hectd1) NP_659037 HECT domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2384768]


Sequence tag IST12824H7HMR1
Sequence
ATACATAGTGAAACCCTATCTCACATCTTANAAAAGGGGACAGGAAGGGGGGAGACAGGGTCAGTGTAGTATCCTTGTAG
CATTATGGGAAAATTTGGTGCAAGCATCAATTATGTTTACTAGATCCACATGTCGCGTTTATN
Sequence Type genomic DNA
Unitrap ID UNI17538

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 35987088..35987229 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048970 (C1galt1c1) NM_021550 C1GALT1-specific chaperone 1 Gene [Source:MGI (curated);Acc:C1galt1c1-001]

 
Come back to gene ENSMUSG00000048970


For any suggestions or comments, please send an email to unitrap@crg.es