Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12248H11
Clone ID IST12248H11
Vector VICTR76
Project tigm

Sequence tag IST12248H11BBF1
Sequence
GCGATTACTTAATATTTTTTGAAATGATTAACAATTTGTTGCACTATTATTGTATACCAGTCTTTGGGCAGTCAAGATGA
TGTAGTTGGAGGAAGCTGAAGGTCTTCTGGGAGCACGAAATACACTTCTCAGTATCCAACAAACTCTTCAATAAAGAATA
TGCATTATGATTTGAAATTCTTCAAATGTACTGGAAAAAATGCTTTGACCTGAGAGCTGAAGGACAGGCAGAGGCTCGGG
CTCAGAATATTCAGAGGGAGGGGAAGGTTTCAAAAAGAGACTTGATTAGAAAGAAAACAAAACTAAGAGTTTTCCTTAAT
TTGATTCTGTGTTGCTGGAAACAAAATTACTATTCTAGAATTATAAGAAATAAGGTCNGTTTTCTGAGTTTTGGGGAAAA
TAATTTTTTTAAAGGAAGAGTTAAGACATACTGGCTGTTTTAAACTTCNAGCTGTAAGTATGGCTTANCACCTGCTTACA
TTTTACAAACAAGTTAGACNAGAAGTGTGCTGCTCATAANGACTCAAGCATGCN
Sequence Type genomic DNA
Unitrap ID UNI19125

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65731694..65732226 523
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032386 (Trip4) NM_019797 thyroid hormone receptor interactor 4 Gene [Source:MGI (curated);Acc:Trip4-001]

 
Come back to gene ENSMUSG00000032386


For any suggestions or comments, please send an email to unitrap@crg.es