Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14537F1
Clone ID IST14537F1
Vector VICTR74
Project tigm

Sequence tag IST14537F1HMF1
Sequence
GGAGGCAGAGGCAGGCAGATTGCTGAGTTCAAGGCCAGCCTGGTCTACAGAGTGAGTTCCGGGACAGCCAGGGCTACACA
GAGAAACCCTGTCTCGAAAAAAGAAAGAAAAAGAAAAAAACCAACTTATTTTTATTTTTTGAGTTTTTTAAGACNGGGTT
TCTCTGTGTNGCCCTGGCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 25030472..25030651 174
NO GENE  


Sequence tag IST14537F1HMR1
Sequence
CTCCCAAGTGCTGGGATTAAAGGTGTGCACCACCACACCCAGCG
Sequence Type genomic DNA
Unitrap ID UNI36353

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 183116746..183116789 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038733 (Wdr26) NM_145514 WD repeat domain 26 Gene [Source:MGI Symbol;Acc:MGI:1923825]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 25030432..25030475 44
NO GENE  

 
Come back to gene ENSMUSG00000038733


For any suggestions or comments, please send an email to unitrap@crg.es