Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST441313
Clone ID OST441313
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST441313
Sequence
CTGGATGCAAGGCCTCTGTTGGAAAAATCAGTGTCTCATCAGACTCAGTGTCTACTCTTAATAGTGAAGATTTTGTCTTG
GTTTCCAGGCAAGGAGATGAGACACCATCTACAAATAATGGGAGTGATGATGAGAAGACCGGGACCTCAAGATTGTAGGA
AATGGAAGTGAGCAGCAGCTTCAGAAAGAGCTAGCAGATGTGCTGATGGATCCTCCCATGGACGACCAGNCAGGGGAAAG
GTCACAACGTGGATGGNGAANGAGATGGNCCTCTTTCTAATCAACTCTCANCCTTCATCCACCATTAATCCTGTGCCTCT
GGTAGGGCTTCCGAAACCAGAGATGAGCCTGCCAGTGAAACCTGGACANGGAGATTCNGAAGTATCAAGTCCTTTTACAC
CANCNGGTTGATGAGGATAGTGTGGNTCTCAATAAACTAACTTACTTAGGCTGTGCTTCAGTAAA
Sequence Type mRNA
Unitrap ID UNI17202

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 37324948..37329189 205
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035437 (Rabgap1) NM_001033960 RAB GTPase activating protein 1 Gene [Source:MGI (curated);Acc:Rabgap1-004]

 
Come back to gene ENSMUSG00000035437


For any suggestions or comments, please send an email to unitrap@crg.es