Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14619D10
Clone ID IST14619D10
Vector VICTR74
Project tigm

Sequence tag IST14619D10BBF1
Sequence
TTCCTGGTGGTGGGCAGCACCCAAGANAGTCTGCATGGCTTCACCCACAAGGTGCGGTCTCTANCCCCTCCCCTCCATGC
TGTCTGCCCTGTGANCCCANAGCTGTCCATTACTTGCCGTTCCAGCCACCCCTTATTTCCGCGTGAAGCCCTGAGCTCCC
TGCGGACACTGGCTGTTTCTTGCCAGGGTAAGAAGCTGTGGACAGTGCANATGCCTGCAGCCNTCCTGACCATGAACCTC
CTGGANCAGCGATCCCGANGCCTGCAAGCTGTCATGGCTGCTCTGGCCAATGGGGAAGTCCGAATTTACCGAGACAAGGC
CCTGCTCAATGTCATCNATGCCCCGGTGAGCAGACGGCATGCCACCGCTGCCGCCNCCGCTGCTGCCNCCGCTGCTGCTG
NNTCCNNNTTACCCNANCCCNATTNATTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14619D10HMF1
Sequence
NTCCTGGTGGTGGGCAGCACCCAAGAGAGTCTGCATGGCTTCACCCACAAGGTGCGGTCTCTAGCCCCTCCCCTCCATGC
TGTCTGCCCTGTGAGCCCAGAGCTGTCCATTACTTGCCGTTCCAGCCACCCCTTATTTCCGCGTGAAGCCCTGAGCTCCC
TGCGGACACTGGCTGTTTCTTGCCAGGGTAAGAAGCTGTGGACAGTGCAGATGCCTGCAGCCATCCTGACCATGAACCTC
CTGGAGCAGCGATCCCGAGGCCTGCAAGCTGTCATGGCTGCTCTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI31908

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4897336..4897623 288
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006464 (Bbs1) NM_001033128 Bardet-Biedl syndrome 1 (human) Gene [Source:MGI Symbol;Acc:MGI:1277215]

 
Come back to gene ENSMUSG00000006464


For any suggestions or comments, please send an email to unitrap@crg.es