Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14765H5
Clone ID IST14765H5
Vector VICTR76
Project tigm

Sequence tag IST14765H5HMF2
Sequence
AAGCAACCGAGCTGGGGTGGAGCTCAGCTGGTATGAAGCCATGGATTCAGTTCCCAGCAATTTGTAAATTGGGGGACACA
TGATGTAATCCTGGTGCTTAGGAGATAAGAAGTGACACAAGTTCTTTCCACAGACAAAAACAAAACAAATGAGTAGCTTT
TTATAAGTGTGATTAATATTCTATTCTTGCTATCTACATATCCCGATTAGTATGCATTATTACTTCTAAAGCTGTAAAGA
ACTGCTGTCCACAATGTCCGAGAGAGAAATGGACTTTATTCTGTGGGCAACGCTGTTTGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 24556066..24556369 304
NO GENE  


Sequence tag IST14765H5BBF1
Sequence
GCCCGTTTTCAAAACATAAACTATTCCTGGTAGATAAGTCATGATTCTATATTTCTGGATATCCAGGAAGAAAATATTAC
TCTGTGTGTATGTGTGTGTGTGTGTGTGTGTGTGTGTGTN
Sequence Type genomic DNA
Unitrap ID UNI17846

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121469758..121469876 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027238 (Frmd5) NM_172673 FERM domain containing 5 Gene [Source:MGI (curated);Acc:Frmd5-001]

 
Come back to gene ENSMUSG00000027238


For any suggestions or comments, please send an email to unitrap@crg.es