Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14462B3
Clone ID IST14462B3
Vector VICTR74
Project tigm

Sequence tag IST14462B3HMF1
Sequence
GGCAAACCCCAGANTGTTTTGGGGGCCGCATTTTCTCCATCTCTCCAGCCTCCCCCTTCCTANTCNCCCCCACACTCACA
TCTCCGGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95622391..95622477 81
NO GENE  


Sequence tag IST14462B3HMR1
Sequence
CCACCGAGCTGCTGCATTCAGTTGGGGTTCACATTAAAGATCGGGCGCGAGTGTTCCCTAGCCCANNCTCCATCCTAGGC
ACGGTTGCCCTGCTCTGCAGGGGGCTCATTGCTTGGAATTTTTCAGCCTCACATTTGGCGTGACCTTGGGCCGTTGGGCC
TANACCCGTANAGATTTTCGCGTTTCCTTCCGANCCCTGNAANGTGTGTTGTTGANNAN
Sequence Type genomic DNA
Unitrap ID UNI9428

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95622177..95622391 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028106 (Rprd2) NM_001081293 Regulation of nuclear pre-mRNA domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1922387]

 
Come back to gene ENSMUSG00000028106


For any suggestions or comments, please send an email to unitrap@crg.es