Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14324G5
Clone ID IST14324G5
Vector VICTR74
Project tigm

Sequence tag IST14324G5HMR1
Sequence
ATAGAAGATTTCCCCTGACCCCTGTGAGGGAGAAATAACTGGAGGTGAGAAGCCCCCACCCCCAGGATGGGGCTCTGGTG
CCAGCTGGATTGTTCTGCTGGAATGTTCCTGCTAGAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 118962927..118963045 119
NO GENE  


Sequence tag IST14324G5BBF1
Sequence
CTATGAGTTCTCCAGCAGANAAGGGGTCCCTCCTGCTAAAGATTGAATGTGTGTGTGTGTATCCATGTGTGTATATTTTG
GTTGGTATATGTCTCTCGGTGTGTGTCTCTTTCTAGGTGTATTTATTTGTGTGTGTCTATTGTGTGTGTCTCTGTATATA
TGTGTGTCTCTATGTGTGTACTGTGTATTTCTATGTGTGTCTGTGTNTNTNNCNGTTTATGTNTNCNCNTGTNTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14324G5HMF2
Sequence
GCCTTAAGACAAAGTTAGAGCCATGCAGAGAAGACAATAAGAAATGGAACATGTCCACTTCTGCAAATGCAGCATTAACG
GGTAACTGTATTTTACCTGATGGCCAGC
Sequence Type genomic DNA
Unitrap ID UNI13373

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35967477..35967583 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022906 (Parp9) NM_030253 poly (ADP-ribose) polymerase family, member 9 Gene [Source:MGI (curated);Acc:Parp9-001]

 
Come back to gene ENSMUSG00000022906


For any suggestions or comments, please send an email to unitrap@crg.es