Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12872D5
Clone ID IST12872D5
Vector VICTR76
Project tigm

Sequence tag IST12872D5BBF1
Sequence
CAGACACGCCACCTCTCTGGTGAGCTGGCCTATAGAGGTTCCCTCCATGGTGGGGAGGGCATCAGGGACTGACTAGGGCA
CTGCAGAACACTCAAGTGGGGAAAGGAGACCATCTCTGGCCTGCATAGAGCTAGGTGGGTCACAGTAACAATGTCTCTCC
TGCTGCTGTAAATATTATTTGGAGGTTTCTACCCCACCTTANNTCATTTTGTTCCCAAATAAAAGACACAAACCTTTATA
TTTATAATAAGTGTTAAAAGCATTAGAGCTGGGCAGATATCAACCCTCTGGGCTATTTTGTCTGCTTCCCTGTCGGGAAC
CCCAGANATCTCTACCTCTGACCCCACACCCAGGAACAGAAGCCCCACCTCCCTCTCTTCTGCTCAGCTACAGCCTGTGG
GCATTTTTATTAACCAATCACAGATAACTTGGGAGGGGGGCNAGTTTATACAACAAAAGCTGGTNNNCACNAGNATCTGC
TCTTCNTGAAGCANCCNNATNNTGGN
Sequence Type genomic DNA
Unitrap ID UNI36360

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79467820..79468324 475
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035722 (Abca7) NM_013850 ATP-binding cassette, sub-family A (ABC1), member 7 Gene [Source:MGI Symbol;Acc:MGI:1351646]

 
Come back to gene ENSMUSG00000035722


For any suggestions or comments, please send an email to unitrap@crg.es