Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST441100
Clone ID OST441100
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST441100
Sequence
TCTTGTAAATAACTGGCTGTTCTCAGTTACTCTGCCAGAGCCTTCACACAGACCTACTAGTGCATTNGTAACCTGGATTT
ATTTCTTAATATATTGGAAGGTTTTGTTTCCTTAGATTAGNAAATTATCATACAGAGAAAA
Sequence Type mRNA
Unitrap ID UNI12880

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114476345..114476480 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031950 (Gabarapl2) NM_026693 gamma-aminobutyric acid (GABA-A) receptor-associated protein-like 2 Gene [Source:MGI (curated);Acc:Gabarapl2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 23623956..23624091 127
 
EST/CDNA Est Name
  AI098419.1 - BG095032.1 - AA667111.1

 
Come back to gene AI098419.1 - BG095032.1 - AA667111.1


For any suggestions or comments, please send an email to unitrap@crg.es