Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST441066
Clone ID OST441066
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST441066
Sequence
ACTGAGGCTTCCTTTGGAAGTTCGAGCCCAGCTGGAAATAATGAATCCCAAATCAACCTTCTACAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI17529

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 112478034..112478373 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032727 (Mier3) NP_766181 mesoderm induction early response 1, family member 3 Gene [Source:MGI (curated);Acc:Mier3-001]

 
Come back to gene ENSMUSG00000032727


For any suggestions or comments, please send an email to unitrap@crg.es