Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14652D10
Clone ID IST14652D10
Vector VICTR74
Project tigm

Sequence tag IST14652D10HMF1
Sequence
GCACAACTCTGCACGTCCTTGGGGTCTCACTGACCAAAAGATCCACCCTGAATGTGGATGGCACCATCTCAGACTGGGAT
CCTGAACTCAGTGCGGGAGCAGGGCTGAGTACCAGCATGTGATGTGGCCAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 83293988..83294118 131
NO GENE  


Sequence tag IST14652D10BBF1
Sequence
GCACAACTCTGCACGTCCTTGNNGNNNCACTGACCAAAANATCCACCCTGAATGTGGATGGCACCATCTCANACTGGGAT
CT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14652D10HMR1
Sequence
GTGCCNTCTAGGTGCCTCCAAATCCACTCAGAATGACAACAGCGGTTC
Sequence Type genomic DNA
Unitrap ID UNI3108

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 83294115..83294161 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042700 (Sipa1l1) NM_172579 signal-induced proliferation-associated 1 like 1 Gene [Source:MGI Symbol;Acc:MGI:2443679]

 
Come back to gene ENSMUSG00000042700


For any suggestions or comments, please send an email to unitrap@crg.es