Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13799F3
Clone ID IST13799F3
Vector VICTR74
Project tigm

Sequence tag IST13799F3BBF1
Sequence
NTCTGTGTGTCCAAGCTGGGGGCCGAGTTCAATGTGACTTCTCCCAGCAACTGTTCCCACCTACCCAGGCCGCCTGCCCT
GCAGCCCTGTCAGGGGCAGGCCTGTGAGGACAAATGGTTCTCCACTCTCTGGAGTCCGGTGAGTGCCTGGCACCCGTGCC
TTGCTCTCCTTGGGCCTCTAACAAAGAGGCCTGCACTCANCCAAGCCTCTCTCGGCCCAGGACAACCCANTCNACCTTTT
GTGTTNTNNNNNTTCCCAAAGACTTGCAGGACTGGGGGACCCTCTCCATTTGGGGTCTTATAATGTTCCTGGAGAATGTT
CTACCACAGTCTCTCANAGAGGAANTGGGTGGCCTGGGGANCANCCCTGANAACNTTNGACATCTNATCNNATGGCTGTG
GTCTCCCNNNTGTNCNCGANCCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13799F3HMF1
Sequence
ATCTGTGTGTCCAAGCTGGGGGCCGAGTTCAATGTGACTTCTCCCAGCAACTGTTCCCACCTACCCAGGCCGCCTGCCCT
GCAGCCCTGTCAGGGGCAGGCCTGTGAGGACAAATGGTTCTCCACTCTCTGGAGTCCGGTGAGTGCCTGGCACCCGTGCC
TTGCTCTCCTTGGGCCTCTAACAAAGAGGCCTGCACTCAGCCAAGCCTCTCTCGGCCCAGGACAACCCAGTCC
Sequence Type genomic DNA
Unitrap ID UNI31232

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95481357..95481588 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]

 
Come back to gene ENSMUSG00000015850


For any suggestions or comments, please send an email to unitrap@crg.es