Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10906F2
Clone ID IST10906F2
Vector VICTR76
Project tigm

Sequence tag IST10906F2HMR1
Sequence
TTTCNNACATTAATTATAAAACTGAAGAGACAGGCAAGCTACTCAGCCTCAGTTTCCCCAGGGGATGATTTTTTTCTGCT
ATCTGGCAGCTTTTTGTGCCATCGTTTGGGACTGGGGACTGGGTGTTTCTAGTCTTGTTCTGGTGTCAGGGCAATGCTGG
CCTCGTGCAGTACGTTTGAAGCATTTTCTCTAACGTTTTTTGAAGAGTTTGAGAGGATTGGTGCTAGCTGTTCATTAGGT
GTTCAGTAGCTTTCTCCTGGTCTCTGTTCTCATTGTCTTGCTCTGGGCACAAACTCANATACTTATGGGCGGGCAAGTCC
TGGCCAT
Sequence Type genomic DNA
Unitrap ID UNI16325

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77950939..77951264 320
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037750 (BC017647) NM_145430 Uncharacterized protein C17orf63 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6P539]


Sequence tag IST10906F2BBF1
Sequence
TTAAGATCATTCGGGCTGGTGAGATGGCTCANTGGGTAANAGCACCCGACTGTTCTTCCGAAGGTCCGAAGTTCAAATCC
CAGCAACCACATGGTGGCTCACAACCATCCGTAATGAGATCTGT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77950820..77950940 117
NO GENE  

 
Come back to gene ENSMUSG00000037750


For any suggestions or comments, please send an email to unitrap@crg.es