Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11627E10
Clone ID IST11627E10
Vector VICTR76
Project tigm

Sequence tag IST11627E10HMR1
Sequence
GTTTAAGTGACTGAATTGTAGGAAGTATAGTATATGTCTTANAAGAACTAGTGAACATTTAGAGAGACAAGGGACAAGAG
TCCCTTTCCAATGATTGAACTCTCTCTTAATCTTTTAAGGAGATAATTATGTTCAAGTGGAAGTATTGGCTTTGAGAAAG
ATAATTCTGGGAATGAACCCGCCTTTGCCTCTTAACTAGTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI30122

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65757923..65758126 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032384 (Csnk1g1) NM_173185 casein kinase 1, gamma 1 Gene [Source:MGI (curated);Acc:Csnk1g1-001]

 
Come back to gene ENSMUSG00000032384


For any suggestions or comments, please send an email to unitrap@crg.es