Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST440954
Clone ID OST440954
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST440954
Sequence
ACTGAGGTGTGGGATAAGAGCGAGNGCGGNGNCTGGCATTGTACAGCTAGCTGGAAGACACATAGTGGATCTGTATGGCG
TGTGACGTGGGCTCATCCTGAATTTGGACAAGTTTTGGCTTCCTGTTCTTTTGACCGAACAGCAGCTGTATGGGAAGAAA
TAGTGGGAGAATCAAACGATAAACTTCGAGGACAGAGTCACTGGGTGAAGAGGACAACTCTAGTGGACAGCAGAACCTCT
GTTACTGATGTGAAATTTGCTCCCAAACATATGGGTCTGATGTTGGCCACCTGTTCAGCAGATGGTATAGTAAGGGTCTA
CGAGGCTCCCGATGTGATGAACCTCAGCCAGTGGTCTCTGCAGCACGAGGTCTCGTGTAAGCTGTGCTGCAGCTGCATTT
CCTGGAACCCTTCCAGCTCTCGTGCTCATCCCCCCATGATCGCTGTGGGAAGTGATGATAGCAGTCCAAATTCAATGGCC
AAGGTTCAGATTTTTGAATACAATGAAAA
Sequence Type mRNA
Unitrap ID UNI1377

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 67938857..67946902 213
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079614 (Seh1l) NP_082388 SEH1-like (S. cerevisiae Gene [Source:MGI Symbol;Acc:MGI:1919374]

 
Come back to gene ENSMUSG00000079614


For any suggestions or comments, please send an email to unitrap@crg.es