Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14521D1
Clone ID IST14521D1
Vector VICTR74
Project tigm

Sequence tag IST14521D1HMR1
Sequence
GGGCACCGTGGTGCACTTCGTTGTCCCTAGGGAAGGGAGGGTCAAGAAGGAGGTTGGGGATTGCANCCTTCNTCTCTGTC
CCACAGCCCGAGGACGAGGAAGATGAGCCGGCCTTGGAAGAGCTGGAGCAGCGGGAAGTGTTGGTGCTGGGCTTGGATGG
CTCAGGGAAAAGCACGTTCTTGCGCATGCTGGCCGGGAAGCCACCGGTGGAANGCCACGTCCCTACCTGGGGCTTCAACT
CTGTTCGGCTGCNNACCNNNAATTTCNAGGTGGACCTGTTANAGAGTGAN
Sequence Type genomic DNA
Unitrap ID UNI20796

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 54677025..54677313 269
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025870 (Arl10) NM_019968 ADP-ribosylation factor-like 10 Gene [Source:MGI Symbol;Acc:MGI:1930788]


Sequence tag IST14521D1BBF1
Sequence
CCCCTGCACGCCATCCACGCGTCCCGGGGCAGGCACCTGTGGTCTGACATTGCAGGGCAGGAGCTGCTTTTTGAGTCCTA
AACTAAAAGTCTCACTTTTCTTTTTGACTCCTCATGATTTCGCGCACAATCTTTCTCATCATAAATCCTTGGCTTCCACG
AACAGTAAACCCAAGACAATCCCAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 54676838..54677027 190
NO GENE  

 
Come back to gene ENSMUSG00000025870


For any suggestions or comments, please send an email to unitrap@crg.es