Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST440929
Clone ID OST440929
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST440929
Sequence
TGAGGAACAATGCTTTCGANTGCAGTTCCTTTNTGAAGGGTGTGATGCTTGGAAGCATCTTCTGTGCCTTGATCACTATG
CTAGGCCACATTAGGATTGGAAACAGAATGCACCACCATGAGCATCACCATCTGCAAGCCCCTAACAAAGACGATATCTC
GAAAATTTCAGAGGCTGAACGCATGGAGCTCAGTAAGAGTTTCCGGGTATACTGTATAGTTCTTGTAAAACCCAAAGATG
TGAGTCTTTGGGCTGCAGTGAAGGAGACTTGGACCAAACACTGTGACAAAGCAGAATTCTTCAGTTCTGAAAATGTTAAA
GTGTTTGAGTCAATTAATATGGACACAAATGACATGTGGTTGATGATGAGGAAAGCTTACAAATATGCTTATGATCAATA
CAGGGACCAATACAACTGGTTCTTCCTTGCACGCCCCACTACTTTCGCTGTTATTGAAAACCTCAAATATTTTTTGTTAA
AAAAGGATCAATCCCAACCTTTCTAT
Sequence Type mRNA
Unitrap ID UNI17538

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 35984797..35985298 490
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048970 (C1galt1c1) NM_021550 C1GALT1-specific chaperone 1 Gene [Source:MGI (curated);Acc:C1galt1c1-001]

 
Come back to gene ENSMUSG00000048970


For any suggestions or comments, please send an email to unitrap@crg.es