Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10407D7
Clone ID IST10407D7
Vector VICTR76
Project tigm

Sequence tag IST10407D7BBF1
Sequence
CTCTAAGAAAGACACATTATTCACTCATCCTGCTGCCAGCTCATTAAAGATTCACAATGATCCTAGAAAGTATTTTAATC
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 4905977..4906085 109
NO GENE  


Sequence tag IST10407D7HMR1
Sequence
GTGGCGGTCACAGTTGTTGTGGAAGCCTTACTGCTCCGCTGGATTGGTCC
Sequence Type genomic DNA
Unitrap ID UNI25300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154713859..154713908 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074656 (Eif2s2) NM_026030 eukaryotic translation initiation factor 2, subunit 2 (beta) Gene [Source:MGI (curated);Acc:Eif2s2-001]

 
Come back to gene ENSMUSG00000074656


For any suggestions or comments, please send an email to unitrap@crg.es