Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10084D7
Clone ID IST10084D7
Vector VICTR75
Project tigm

Sequence tag IST10084D7BBF1
Sequence
CTTCTAACTACCCAAGCAGTGGTGGCGCACGCCTTTAGTCCCAGCACTTGGGAGGCAGAGACAGGCGGAGTTCTGAGTTT
GAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCAAAAAACAAAAAATT
AAAAATTAAAAAAAAATCCTTCTAACTATAAACCAGGAAGCCACATCAAGACACAGAAGCCAAGGGGTGGGAAATATGGC
TCGGCAGTAGAGAACTTACCTAAGTTATCCCTAGTCGCTCTTCCTGCCCCCTCCCAAGTCAGAATCTAAACCTCAGGTCA
GCCATTCAATGGTCTGGAGGAGGTCCAAGCACCTGTTTTATCAAAGCTGTTTGTAAATCTGACTCGGGGTTGGAGGGCAA
CTCCCTAATGCAGAAGAATCAAACTCTTCCAGATTAGAGGAATCAAGAGCCTGAGAACCTAGCAATATCAGAACCAGGAA
CATGTCCGAGACATGCTGAGGATGGGACACGTCATAAAGCATTTACCTAGCATAGCCAAAGCCCTGAGTTCTGTCCTTAA
AAGCCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87584945..87585508 564
 
EST/CDNA Est Name
  AW124157.1


Sequence tag IST10084D7HMF1
Sequence
CTTGTAACTACCCAAGCAGTGGTGGCGCACGCCTTTAGTCCCAGCACTTGGGAGGCAGAGACAGGCGGAGTTCTGAGTTT
GAGGCCAGCCTGGTCTACAGAGTGAGTTCCATGACAGCCAGGGCTACACAAAGAAACCCTGTCTCAAAAAACAAAAAATT
AAAAATTAAAAAAAAATCCTTCTAACTATAAACCAGGGAGCCCCGGGAAGACACAGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87585293..87585508 200
 
EST/CDNA Est Name
  AW124157.1


Sequence tag IST10084D7BBR1
Sequence
GAAGTTTTAACCCTGTGTCCCTGGATCTAAACCCAGAAGAGTTGGTTAATCTTGAGGCCCCTGGGGAGAATTGAGAGAGA
AATTACTGTCACCTGGGCTAGGGTTTGAGAATGAAGCCTGTAAAAATGTTAGTCTCGGTTTCTTAGAGCTGGGGTAAATA
TTCTTAGTTCTGCATGGGAGATGGGTGGTCAGGTAGCCTGAGACAAAGCCAGAGCCTGTGCCTGTTTGGGATCCG
Sequence Type genomic DNA
Unitrap ID UNI21331

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87585505..87585739 231
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008167 (Fbxw9) NM_026791 F-box and WD-40 domain protein 9 Gene [Source:MGI (curated);Acc:Fbxw9-001]

 
Come back to gene ENSMUSG00000008167


For any suggestions or comments, please send an email to unitrap@crg.es