Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10065E5
Clone ID IST10065E5
Vector VICTR75
Project tigm

Sequence tag IST10065E5BBF2
Sequence
ATGCTACTTTTGTTTATCTTAGTACAAAGTCCTACTGCTTGAACCAAAGAACCCATCTGATGCATTTTATAGGTTTGGGA
ACAGTCCTATTGCTGTGGTCTGGATGAGAAATGTCCACCATGGGCTCCGGCTGGTATCTGAATTCGTGATGCCTCAACTA
CTGGCACTGGATAGAAAGAGAACTTTGAATGGCCCTGGTGGAGAGTCACTGGGGGCTGGCTTTGAAGCTGCATAACCTGT
CCCTAGCTCCTGCTCTCTGGCTCTTCTGGACTGCTGGTACAATGGGGCAGGCCATCCTCTTCGTCCTATCACCGAGCATT
TCCTGCCAGGATGGACAGTGTCCCCTTTGGAACTCAAAGCCCAAAACAGCCTTTTCTCCCTTCAGTTGCTTTGGTCAAGG
TATTTTGTCATTGCAACAAGAAACCAAGTTAACATACCTTCCCGTCTCTAAAATGGAGGCCTCTAAGATCCTCTACAGCT
ACGGCAGCAGGACAAGTCCTGGCAGGCATGCCCCATCCACCCATGATAGTACTGTGACCTGCTCTTAAAGGACTTACACG
C
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 94774521..94775080 553
 
EST/CDNA Est Name
  BQ828946.1 - CX242575.1 - BQ178404.1 - BF464383.1 - BQ571215.1 - BX520535.1 - BI145856.1 - CB203532.1 - AI430259.1 - AI426523.1 - BB659142.1 - BB813355.1 - BY734078.1


Sequence tag IST10065E5BBR1
Sequence
ACTGAAGGTGATAGTTTCACTAAATGTATGAATTTTATAATAGAATTGAGGCCAGTATTAGGTACCATAAATTTTAAAAA
TATTTTCTGTTAACTGTTTAGCATACTGCATACTTAGCTTTTGTTTTATATTAAATGTACCTATTCAGGCCTTTTAAATT
TATTTTGTTAATAAAAAAATTAAACCCATTTGTTAATAAAGTCTCTTTTCTCTTTTTAAAAAAACATTTTAATATACTTT
TAATGATCATTCTTAAATTCAAGATCAAGTATACATCTTAAACAGCTATAATAAAAAATAAGTCTGTAATATTAATTGCA
ATTTTGAAGGGTTTCATGTAATTTTCCAAAGTAAATTTACATTCTTAGATATTTGGAAAATGTTACAATTCACCAATACT
ATTTATTTTCATTTCTTTTATGTGACACGTTGGTTCAATGATTAATCAGCAGGCATTTTAATAACATAATAAAATTGCCT
AAATAATTGATACCAGTTCACACTAAGAGAAAGGTGGAGTAATATAACTAATAGTGTTAACAAAGTTGCTAAAAGGCCTG
AGTAGGTACACGGTGAGGCGATGGCTTTTAGGCTGTCTGATTGCAAATGCCATTTTTTTTTTA
Sequence Type genomic DNA
Unitrap ID UNI1569

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 61589785..61590408 606
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026914 (Psmd14) NM_021526 proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 Gene [Source:MGI (curated);Acc:Psmd14-001]

 
Come back to gene ENSMUSG00000026914


For any suggestions or comments, please send an email to unitrap@crg.es