Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12411H11
Clone ID IST12411H11
Vector VICTR76
Project tigm

Sequence tag IST12411H11HMF1
Sequence
CTAGTCAGTAACAGTATTTTTGTGTTGGGCAAAGCAGTTTCTGAACCTTAGCATCCTCACAAGTAAAACAGGTTCAGACT
CACCAGTGGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI35307

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72886869..72886962 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079469 (AC158997.2) NM_018889 GPI mannosyltransferase 3 (EC 2.4.1.-)(GPI mannosyltransferase III)(GPI-MT-III)(Phosphatidylinositol-glycan biosynthesis class B protein)(PIG-B) [Source:UniProtKB/Swiss-Prot;Acc:Q9JJQ0]

 
Come back to gene ENSMUSG00000079469


For any suggestions or comments, please send an email to unitrap@crg.es