Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14804B4
Clone ID IST14804B4
Vector VICTR76
Project tigm

Sequence tag IST14804B4HMF1
Sequence
CAGTGTATCCTCTGTAACCCCAAAACTCATCAGGCTGAGATGGGCAGATCCTTAGAGCTTGCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45592154..45592218 65
NO GENE  


Sequence tag IST14804B4HMR1
Sequence
CTGCACCTGGCTTTTGCATGANAACTGCGGATCTGACCTCAGGTCTTTATGCTTGTGCCATACCCTTCTTCCCACCCTGC
ATTTCCTCTTCATTTTTTTAAAAACATTTTTTATGTGTCTAAGTATTTTACCTACAGGTATGCCTACATGTGTAACTACA
TGTGTGCCTAGTGGAGGCCAGGAGCAGGTATCANATCCCCTGGGGCTANAATTATGGAGAGTTGTGAGTTTTCTTTGTGT
N
Sequence Type genomic DNA
Unitrap ID UNI13393

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45591917..45592156 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]


Sequence tag IST14804B4BBF1
Sequence
CAGTGTATCCTCTGTAACCCCAAAACTCATCAGGCTGAGATGGGCAGATCCTTAGAGCTTGCTGGCCAGCCTCTACAGCC
ACGGGAGTTCAGTGAGAGACTCTGAATCAAGAAGGAAGGGAGAGTGCCAGGGCATCATGCATGCTAGGCAAGCACACTAC
CAACTGAGTGCCATTTTATTCTATGATTGATATTTTAAAAACTAAAAACAGAGACGTGTGCTACGCTCTCCGGTCGAGTC
AACTGGACAAGCCGAAAGGCTTAAAAGTCACTCATGAGGCAAAAGAGTTTCAAGGAAGCTCTCCTGGAGTCTAGTGTTCT
CTACCCATACATTAATTTTTCATTCCCGAGTTCCATTACCGCGCTAGTCTANAGTATGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45592154..45592535 380
NO GENE  

 
Come back to gene ENSMUSG00000023935


For any suggestions or comments, please send an email to unitrap@crg.es