Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14442G12
Clone ID IST14442G12
Vector VICTR74
Project tigm

Sequence tag IST14442G12HMR1
Sequence
GTTGATAGGTAACGGAATGTTTTAAAGATAAGAGATCAAGACCNTANCCNGGTGTGGTGGCCCCCTTCTGTTAATTCCTG
CACTCTAAGGTTGCAATCTTATATTAAAAGTAAAATACATTTAAAAC
Sequence Type genomic DNA
Unitrap ID UNI29561

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 54645147..54645272 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031134 (Rbmx) NM_011252 RNA binding motif protein, X chromosome Gene [Source:MGI (curated);Acc:Rbmx-004]

 
Come back to gene ENSMUSG00000031134


For any suggestions or comments, please send an email to unitrap@crg.es