Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11037F9
Clone ID IST11037F9
Vector VICTR76
Project tigm

Sequence tag IST11037F9BBF1
Sequence
AGGGAATTANTNTTCCTAANAGCTATTCACTTGCNCAAGCGTAATAAAACAACAGCACTCCCCAGATGTATGGTGTGTGC
CTATATCTCATCGATGGCAGGCGGAGGCTGAAGAATCCTGAGTTCGACTAGACGTANCCCCTACCTCANAATGACAACAA
CACTTGCAAGAGGAAATGTGGAGAGAAGATTAGCCCAGGATTGACAAACAGGAAGAGAGAAGAAGCTCGGGCCAGATGTG
CTAAATGTCAGCGTGCAGGAAAGCACTCAACTGCTTAGAAATTTTATTACAGAAAAGTTGTTTCGTTTTGAAATCTAAGA
TCTG
Sequence Type genomic DNA
Unitrap ID UNI15985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66515316..66515638 311
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]

 
Come back to gene ENSMUSG00000019873


For any suggestions or comments, please send an email to unitrap@crg.es