Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11761B9
Clone ID IST11761B9
Vector VICTR76
Project tigm

Sequence tag IST11761B9BBF1
Sequence
AGCCGACAGCGGTGTTTGTATTTCCTGGCTGCTGCCGCGGCATGCTTANCTCCTGTCTGATCCAGCACTCCGGAAGCAGC
CTGGGCTCCCTCTCACAGGCTGAANCAGGCTTANTGACGTCAGGCAGTTTCCAAGGTCANAGGGTACAGTCCTGGCTCAN
CANTTTGCAGGCCCGGTGCANGGAGGCCTGTGAACCNNANGTCTGGANATCTGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11761B9HMF1
Sequence
AGCCGACAGCGGTGTTTGTATTTCCTGGCTGCTGCCGNGGCATGCTTAA
Sequence Type genomic DNA
Unitrap ID UNI14064

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96606253..96606300 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040433 (Zbtb38) NM_175537 zinc finger and BTB domain containing 38 Gene [Source:MGI Symbol;Acc:MGI:2442866]

 
Come back to gene ENSMUSG00000040433


For any suggestions or comments, please send an email to unitrap@crg.es