Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13824D6
Clone ID IST13824D6
Vector VICTR74
Project tigm

Sequence tag IST13824D6BBF1
Sequence
TTTGTAGCTGTCTTCAGACACACCAGAAGACGGCATCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI6313 UNI13402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 27744178..27744218 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 72191509..72191549 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 73646483..73646523 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 119099263..119099303 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018076 (Med13l) NP_766012 mediator complex subunit 13-like Gene [Source:MGI Symbol;Acc:MGI:2670178]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 130374280..130374320 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030769 (Slc5a11) NM_146198 solute carrier family 5 (sodium/glucose cotransporter), member 11 Gene [Source:MGI (curated);Acc:Slc5a11-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27071962..27072002 41
NO GENE  

 
Come back to gene ENSMUSG00000030769


For any suggestions or comments, please send an email to unitrap@crg.es