Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15031F3
Clone ID IST15031F3
Vector VICTR78
Project tigm

Sequence tag IST15031F3BBF1
Sequence
ATTTAGCAGCAAGCCCTCTGATATGGGCACCCTGAGCTGGGAGTCTGTATTCAAGGCAAGGGCAGGCAGTGAAATGACTT
AAGAGACTAAGAAATGCCCCTAAACGTGGTGGCTTCCTCCCATCTGANACACTTCCATTTTTCCAATCTTGCTTCTTTGC
TGAGCCCTTCTTAAGCTCTGCCCTTAAAAAAAAAAAAAAANNNANGGN
Sequence Type genomic DNA
Unitrap ID UNI22426

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28117146..28117345 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]


Sequence tag IST15031F3HMR1
Sequence
GTTTTACANNCNNTCTTGCCTGCTCCTTANTGATCTTATGTCNNAGCCTTAAGGCATGGCTAGAGAGGTGAAAATTTTCA
TGATCACAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040488


For any suggestions or comments, please send an email to unitrap@crg.es