Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14567C1
Clone ID IST14567C1
Vector VICTR74
Project tigm

Sequence tag IST14567C1HMF2
Sequence
CTAACTTCTTTGTGACTTACAGTAAAAACTTCTCTAAACATTGATCTTTTTTTATCTCTTCAAATTGCAATCCTTCCTAT
CCAGTGTGCCTCAAAAATCAGCCTAGCATCTAATTTAGTTGAAAAGGTAGTGGGGGGAGATAGTTCTGCGCGCGCGCGCG
C
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 129252992..129253152 161
NO GENE  


Sequence tag IST14567C1BBF3
Sequence
NTGATCAAGCTGGGTATCTGCATGCAGACAAATGAAAATAAATCTATACCCATCACCCTGCAAAAACCTCAAGTCCAAGT
AGACCAGAGACATAAAACTGAATACACTGAAACCGATAGAAGAGAAAATAGGGAATGGATCTGAATGCATTGGCACAGGA
ACGAGATAAGTTTCTGAACAGAACACTGACAGTCTAGACACAAAGATTAACAATTAATAAATGGGACCTCATGAAACTGA
AAACCTCTGTATGGCAAAGGATTCCATCAATTGGACAAAATGGCAGTCTCTAATAGAGATTAGAGATTAATAAAGATTTT
TGCCNATTCTACATCCACTAGAGATTAATATTCAAAATATATAAAGGACTTAAGAAACTAGACATCAACAAACCAAATAA
TTCNNTTAGAAAATGGGATACAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 17220517..17220942 420
 
EST/CDNA Est Name
  AA611157.1 - AI607220.1


Sequence tag IST14567C1HMR1
Sequence
NNNCNGCATCATTCGTTGAAGATGCTGTCTTTTTTTTCCCAGTAAAAATCAGATGCCCATAGGTAGATGGATTTATGTCT
GTATCTGCAGTTCTATTCCATAGATCAATGTGTCTGTTTTTATGCCAATATCATGCAGTTCTTATTAATGTATCTCTGTA
GTCCAACTTGAAATCATGGCTGGTGATACCTCCAACATTTTGTTGTTGTTGTTGAGGATTGTTTTACTATCCTAGGGTTG
TGTGTGTGTGTGTGTNNTTTA
Sequence Type genomic DNA
Unitrap ID UNI13002

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 17220943..17221197 251
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039126 (A230083H22Rik) BNIP2 motif-containing molecule at the C-terminal region 1 [Source:UniProtKB/Swiss-Prot;Acc:Q52KR3]

 
Come back to gene ENSMUSG00000039126


For any suggestions or comments, please send an email to unitrap@crg.es