Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14569H12
Clone ID IST14569H12
Vector VICTR74
Project tigm

Sequence tag IST14569H12BBF1
Sequence
CCATCGCCATTTTATGGATGTGAAAACTGAGGCTCACTGGAGCCAAGTGACACGCCCACCACTTAAAGCTCCTCACGCAC
TGCTTTCTAAAACCTATGTCCACAGTCAGGAGAGCTTTTTGCCATAAACAAAGGGTATGCATTCCTTGTCCAGCCAGGAC
ATCCAAGGCTTAGCCCAGAACTTTCTCCAACTGTAGCACATGTTGTTGCTGGAAGCTTATGGTGATGGGCCCTAACTGGG
AAAGATCTGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 133227804..133228053 250
 
EST/CDNA Est Name
  BY767212.1 - AW321251.1 - BY329701.1


Sequence tag IST14569H12HMR1
Sequence
GTAATTACACAGTCTTACTGGTGTCTAATGAGATCTCTGGANCCTATTTNACGGGTAAATTAAAGAAAAATGAAACTGGT
TGGTTCTAAGCATCCGGCCAGTTAAGAGTCTGATTTGGCAAGGGGCTTCTTTCAAAGGGGTGTTGGCAAAATANCTAGAG
AGATAATTGACTGTCTTGATTTTACTTTGTTTAACTTGAGTGTGGGTTGCATCTCCTGTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI8531

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 133227582..133227804 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043257 (Pigv) NM_178698 phosphatidylinositol glycan anchor biosynthesis, class V Gene [Source:MGI (curated);Acc:Pigv-002]

 
Come back to gene ENSMUSG00000043257


For any suggestions or comments, please send an email to unitrap@crg.es