Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10091G8
Clone ID IST10091G8
Vector VICTR75
Project tigm

Sequence tag IST10091G8BBF1
Sequence
ATCTCAGATTAAAGGTTGACCCAGAAAATGAGTGCTCTGAATCTGGCCACGATTCATCAGAGAACTGACCCATCTTTTTC
AGTGCTTGCTAATGATTCGGACCATATCATGGGGCTCTGGGACTTCCGGCTTCCTTGTACTTCACTGACCTTTATGTGTC
CCGGTGACTGCCTTTAGCTTGCTAACTGCCGTCTGTGTTTCTCTGAGCCTACTCAATAAAAAGAGTTAAGAATAAAATAA
AATAAGCCAAATGCACCCCTTTAAACCCTGCAGAGGCGGGCAGAGCGCCCTGAGTTCAAGGCCAGGGTAGTCTTCATAAT
GAGACCCTGACACGACAAAAGAAAACCAAAATAGAGTTCCCCAATCCATCATTCCTGGCTCAAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 138465899..138466286 362
NO GENE  


Sequence tag IST10091G8HMF1
Sequence
AGGGCTATACAGAGAAACCCTGTCTCGAAAAACCAAAAGGA
Sequence Type genomic DNA
Unitrap ID UNI36382 UNI36383 UNI36384

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 49934931..49934971 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62119443..62119483 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 82062088..82062128 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021135 (Slc10a1) NP_035517 solute carrier family 10 (sodium/bile acid cotransporter family), member 1 Gene [Source:MGI Symbol;Acc:MGI:97379]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49818668..49818708 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037851 (Iars) NM_172015 isoleucine-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2145219]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 34039824..34039864 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 38964981..38965021 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 25460708..25460748 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015087 (B230208H17Rik) NM_001024616 RIKEN cDNA B230208H17 gene Gene [Source:MGI Symbol;Acc:MGI:2442633]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 105843335..105843375 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87587098..87587138 41
NO GENE  

 
Come back to gene ENSMUSG00000015087


For any suggestions or comments, please send an email to unitrap@crg.es