Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST440612
Clone ID OST440612
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST440612
Sequence
ACTGAGAGAATGCAGGCAGTAGTTCAGATGGACCGAAGATTCCGATTTTTCTACAGATCTCGAGCATACAGACAGTTCAG
AGAGTGATGGCACCTCGCGCCGATCTGCCCGAGTCACCCGCTCCTCAGCCAGGCTAAGCCAGAGTTCCCAAGGTGTTAGA
TTCCAGCCCTGTTCGAAATTTGCCGTCTTTCGGCACTGAGGAGCCTGCCTATTCTACCAGAAGGGTGACCCGTAGTCAGC
AGCAGCCCACGCCAGTGACTCCAAAAAAGTACCCTCTTCGACAGACTCGCTCATCTGGCTCTGAAACGGAGCAGGTGGTG
GACTTTTCAGATAGAGAAACATGACATAGTGCGGCGTGGGGAGATCATAGACAATGACATGGAGGACGAGTTCTACCTGC
GGCGCCTGGATGCCGGGCTCTTCATCCTACAGCACATCTGTTACATCATGGCGGAGATCTGCAATGCCAATGTCCCCCAG
ATTCGCCAGCGGGTTCACCAGATCCTGAACATGCGTGGCAGCTCCATCAAGATCGTCAGGCACAAA
Sequence Type mRNA
Unitrap ID UNI17568

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95164447..95167511 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038909 (Myst2) NM_177619 MYST histone acetyltransferase 2 Gene [Source:MGI (curated);Acc:Myst2-002]

 
Come back to gene ENSMUSG00000038909


For any suggestions or comments, please send an email to unitrap@crg.es