Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11139C8
Clone ID IST11139C8
Vector VICTR76
Project tigm

Sequence tag IST11139C8HMF1
Sequence
TGGCCGANGTGGGGGTGGGGGCAAAGTGAAGGCAGAGGANTCCTGCTAGCCCAGGCGGCTTGCTNTGNNGGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11139C8BBF1
Sequence
TGGCCGAGGTGGGGGTGGGGGCAAAGTGAANGCNNAGGANTCCTGCTAGCCCAGGCGGCTTGCTCTGCGGGTGGCCAAGA
TGGAGCGCAGGAAGGCTTCTCAGCGGGAGGTTAGACACGCAGCTTGTTANAGGGAAACCTGCTCCAAGATCCAGCACGGT
GGATCT
Sequence Type genomic DNA
Unitrap ID UNI14116

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8886933..8887097 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025277 (Abhd6) NM_025341 abhydrolase domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1913332]

 
Come back to gene ENSMUSG00000025277


For any suggestions or comments, please send an email to unitrap@crg.es