Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14275C4
Clone ID IST14275C4
Vector VICTR74
Project tigm

Sequence tag IST14275C4HMR1
Sequence
AGAGCACTGACTGCTCTTCCAAAGGTCCTAAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTAATGGGA
TCTGATGCTCTCTTCTGGTGTGTCTGAAGACAGCTACAGTGTATTTACATATAATAAANAAATACATCTTTAAAAAAAAA
AGG
Sequence Type genomic DNA
Unitrap ID UNI27871

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108289986..108290148 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011831 (Evi5) NM_007964 ecotropic viral integration site 5 Gene [Source:MGI (curated);Acc:Evi5-001]


Sequence tag IST14275C4BBF1
Sequence
CTCTTACCCGCTGAGCCACCTCTCCAGCCCCTGATGCCCTCTTATAATAATAAGATCAAAAAAAAAAAAAAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108290145..108290217 73
NO GENE  

 
Come back to gene ENSMUSG00000011831


For any suggestions or comments, please send an email to unitrap@crg.es