Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15059E3
Clone ID IST15059E3
Vector VICTR80
Project tigm

Sequence tag IST15059E3HMR1
Sequence
GGTGGCTTTTCTCTATGTCCTCAGGTCTTGTTCCCGAAGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104159974..104160015 42
NO GENE  


Sequence tag IST15059E3BBF1
Sequence
CACCCGGCCTCTGAGCTGCTGCGGCGAGGGCCACCTCAGAAGGAAGGCTGGGGCCAAGACAGGCTGGGGAGTGAGGAAGA
GGTGGATGAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI30785

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104160012..104160106 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es