Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13607E5
Clone ID IST13607E5
Vector VICTR74
Project tigm

Sequence tag IST13607E5HMF2
Sequence
CNGACCAAAATTGAATTGTCTTAATTAAAAACACCATGACCAAAAGCAGCTTGGCGAGGAAAGGATTCATTTCACCCTAT
AAGCTTTAGGTCACATTCCATCACTGAGGGAAGTCAGGGCAGGAACTAAGGAACCTGGAAGCAAGAACTGAAGCAGAAAC
CTGAAGGAGATATGCTTACTGGCTCGCTTCTCATGGCTTGCTCANCCTGCTTTCNTANANCATTCANCACCACCANTCCA
AGGGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35764967..35765209 229
 
EST/CDNA Est Name
  BE457313.1


Sequence tag IST13607E5HMR1
Sequence
ACATGAGGAAGCCTATTTTCAGCGCCACGCTTTTGATTGGTGATGGAGGGTGATGTCCTCAGAGAGGAAAGACTGAAAAG
AGTAACTGGAACAGATAGTGCGGTTGGACGCAGAAAGGCCGGGAGTACTGAGTTTAGGCGGGAAAGTCCAGTTGGTAAAA
ACCTTTGCAGGTCTTACAAAGGAATTTTTTGAAAACGGTTTTGACTGGAGGTTAAAAGTTAATCTAGAGTGGATTTCTCC
CCTAACCTTGGGGGTGAAGGTTGCTGACCTGAGGATTCTACCCCATAGTCTTGTATTTGGACTGGGTGTTCTAACTTTGA
TTGGTATTTAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI543

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 48547521..48547859 339
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023994 (Nfya) NM_010913 nuclear transcription factor-Y alpha Gene [Source:MGI Symbol;Acc:MGI:97316]


Sequence tag IST13607E5BBF1
Sequence
GAAACAGCCTGTTAATCANGTGTGTATGCATTTGCGCCTTTCACTTCAAAAACCTTNTGCTTCATCCCAAGAGGGGTCTG
GTAAACCCTGAGCCTTGAANACTCANTCCATCTTAAAGGCCACTTCTTTAAAACTAAAGCTGGANAGCCTGGGAGGANAA
TAGGCTGGGGCTCACAAATCANTCCNNATGGTTCAGATAAAATGACNCANCGTTTCCCNAGAATATGGGACTGAANANCA
GGGCNNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000023994


For any suggestions or comments, please send an email to unitrap@crg.es