Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST440452
Clone ID OST440452
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST440452
Sequence
TAATTCGAAGATTACCTCCCCTTTGACCAAGGAACAGCTTCAGGAACATCTTCAACCTATGCCTGAGCACGATTATTTTG
AGTTTTTTTCTAATGATACTAGCCTTTATCCTCATATGTATGCCAGAGCATATATCAACCTTTAAAAACCAAGAAGACAT
TCTTTTATTCAGGGACCGATTTGATGGCTATGTATTCCTTGACAATAAGGGTCAAGAATATCATGCTATAGTAGAATTTG
CACCATTTCAAAAAGCTGCAAAAAAGAAGATTAAGAAAAGAGATACAAAAGTTGGGACTATCGAGGATGATCCAGAATAC
AGAAAATTTTTGGAGAGTTATGCCACAGACAATGAGAAAATGACATCTACTCCAGAGACATTGCTGGAGGAAATTGAAGC
CAAAAATCGAGAATTAATAGCTAAAAGGACAACGCCCCTTTTGAGCTTCCTGAAGAACAAGCNCAGAATGAGAGAAGAAA
AGAGAGAAGAAAGGAGGCACA
Sequence Type mRNA
Unitrap ID UNI17576

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34639652..34649245 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036572 (Upf3b) NM_026573 UPF3 regulator of nonsense transcripts homolog B (yeast) Gene [Source:MGI (curated);Acc:Upf3b-001]

 
Come back to gene ENSMUSG00000036572


For any suggestions or comments, please send an email to unitrap@crg.es