Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST440380
Clone ID OST440380
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST440380
Sequence
AAGTCAAAGGAAGCCCAAAGGGAGGTCATTTCTACAGTTCAAAGTCTGAGATACTCAGAGCAATGCAACGTGCAGATGAG
GCCTTAAGTAAAGACACGGCTGAGAGGCTGCAGCTGGCAGTGTGTGATGAGCCTTCAGAGCCGGAGGAGGAGGAGGAGAC
AGAGGTCAGTCACTCCATTCTCTTAGGGGGGAAGGAGGATATGATGTGTATGTGATGAAGNGAGAAATAATAAAAAA
Sequence Type mRNA
Unitrap ID UNI5508

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 88382790..88383027 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005370 (Msh6) NM_010830 mutS homolog 6 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1343961]

 
Come back to gene ENSMUSG00000005370


For any suggestions or comments, please send an email to unitrap@crg.es