Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10947C7
Clone ID IST10947C7
Vector VICTR76
Project tigm

Sequence tag IST10947C7HMF1
Sequence
AAACCTGAAAATTTGACTGGCAACAAATGGCTACATCTGTAGAATTCTATTAAGTACAAGCGAGGAACACGGATGGTGGT
CAAGTGGCAGCANGCAGTCTAGTGGCAGAGGAGAGAGCTTACTCGTTCTTGCNTGTTTTCAAAAGTGAATAAAGTAA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102933092..102933247 152
NO GENE  


Sequence tag IST10947C7HMR1
Sequence
TTTAAAGGACTTTTGTAGCTCTCAAAGTTTCTACTTTCTTCCCCCTCAGTTTTTCCTATGTTC
Sequence Type genomic DNA
Unitrap ID UNI14457

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102933245..102933306 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007379 (Dennd2c) NM_177857 DENN/MADD domain containing 2C Gene [Source:MGI Symbol;Acc:MGI:3036254]

 
Come back to gene ENSMUSG00000007379


For any suggestions or comments, please send an email to unitrap@crg.es