Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12583G8
Clone ID IST12583G8
Vector VICTR76
Project tigm

Sequence tag IST12583G8BBF1
Sequence
GGTNAATCCTCCANGNAAAAGAGCNNAGACCTGCTGANGTGCTGGCTGAANGANAANNNAATACAGAATGGGTANTANAG
GNAGGTAGTTATAAATACCAATTAAGGNNNCGTAACCNGTTGCAGAAACGANGGATTATAAAGTAATATGAATGCNCATT
GTAAATTTACTAATGCNTTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12583G8HMF1
Sequence
GGTCAATCCTCCAGGAAAAGAGCCAAGACCTGCTGAGGTGCTGGCTGAAGGAGAAGGAAATACAGAATGGGTAGTANAGG
AAGGTNNTTNTC
Sequence Type genomic DNA
Unitrap ID UNI31001 UNI31003

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11253460..11253544 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048960 (Depdc2) NP_001028808 phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2 Gene [Source:MGI Symbol;Acc:MGI:1923385]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30296252..30296336 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69975007..69975091 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 12871777..12871861 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 28715274..28715358 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8905865..8905949 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 14368072..14368156 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 63201804..63201888 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 9926689..9926773 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 17716462..17716546 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 44298656..44298740 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025202 (Scd3) NM_024450 stearoyl-coenzyme A desaturase 3 Gene [Source:MGI Symbol;Acc:MGI:1353437]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 34790502..34790586 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 24303739..24303823 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40413360..40413444 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 47549725..47549809 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 41965188..41965272 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20488077..20488161 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3778336..3778420 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 8053882..8053966 83
 
EST/CDNA Est Name
  AA690045.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_109319: 146664..146748 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166281: 185512..185596 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166435: 89380..89464 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166437: 34023..34107 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 39245323..39245407 83
NO GENE  

 
Come back to gene AA690045.1


For any suggestions or comments, please send an email to unitrap@crg.es