Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12511A7
Clone ID IST12511A7
Vector VICTR76
Project tigm

Sequence tag IST12511A7HMF1
Sequence
GAACTTAGCTCTTCTCATTCCCATACACACGACTCAAAAATCGTGTGCTGATGAGAGCG
Sequence Type genomic DNA
Unitrap ID UNI36390

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13672632..13672690 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079737 (3110001I22Rik) NM_025653 RIKEN cDNA 3110001I22 gene Gene [Source:MGI Symbol;Acc:MGI:1913848]

 
Come back to gene ENSMUSG00000079737


For any suggestions or comments, please send an email to unitrap@crg.es