Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14507C2
Clone ID IST14507C2
Vector VICTR74
Project tigm

Sequence tag IST14507C2HMF1
Sequence
AGTATCCCTGTGAAGGAAAANNNANNCCANNAATGATAGCCNNCNCTTAATGGTATTTCGCTCCGGCNACTCTCAAGTCT
GAGAGACAGTGTTCTTGATCTGCAGTTCGAGTCCCACACACCCGTCAGATTCCAAAGTCCACTGGGCCCGAAAGCCTGGG
AATCCCCCGATCACTGGGGGTAAGCTCCAGGAAACTAATGACTCANAGTGCTTCGCTGTGTCCCTCGGCGTCNTCCNNNN
NNNNNNNNNNNNNNCATGCGCCCGATGATTCGGCAGCCGGCGATGGATGCGTGCACCACGGGAATGGNNTCGGAGAGCTC
ACCCNCNANCACACTGTANAANCNCGGATTCGCTGCTTACTGGGGTGGGTCGCTCTTTNNNNCNTNTCGCTCTCCGCCTC
CCTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14507C2HMR1
Sequence
TCTCCTCCTTTCTTCCTCANAAATCTTTANCAATGCTGTGGGGCAGGGACCANNCTAGGGGAAGACACAGAAGCAGCAAC
TACATCTTTCTCCCTGGGAGCAGATTGACTCGTTTTCCCGTGTGGCTGTGGAGTGAGGAGTGAAGTTTTTGAACAATAGT
AGTTCATGGGAATGGTTGAGCGGTGAAATGCAATTCGTCAAGAGTCTCCATCATTGTCACCAGCATGGTGTGAGTTCAGA
AGGACTGCTANACACTTCTTTATAACCTACCATCACCAACAATGTCNTTTTCCTCGTACGATGGGTTGGTAGGATTTANT
GACACAGTGTGTGTGANNTTC
Sequence Type genomic DNA
Unitrap ID UNI15384

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10305253..10305588 322
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036098 (Gm98) gene model 98, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2684944]


Sequence tag IST14507C2BBF1
Sequence
AGTATCCCTGTGAAGGAAAAACGAGACCAAGAATGATAGCCAGCACTTAATGGTATTTCGCTCCGGCTACTCTCAAGTCT
GAGAGACAGTGTTCTTGATCTGCAGTTCGAGTCCCACACACCCGTCAGATTCCAAAGTCCACTGGGCCCGAAAGCCTGGG
AATCCCCCGATCACTGGGGGTAAGCTCCAGGAAACTAATGACTCAGAGTGCTTCGCTGTGTCCCTCGGCGTCTTCNNNNN
NNNNNNNNNNNNNACATGCGCCCGATGATTCGGCAGCCGGCGATGGATGCGTGCACCACGGGAATGGCATCGGAGAGCTC
ACCCTCGAACACACTGTANAAACACGGATTCGCTGCTTACTGGGGTGGGTCGCTCTTTTCANANCTCTCGCTCTNCCGCC
TCCCTTCCCTTCCCNGCCCCGGCGGCTCGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155651614..155652042 235
 
EST/CDNA Est Name
  AK165946.1 - AK012218.1 - AK007594.1 - AK134364.1 - AK167422.1 - AK151559.1 - AK088707.1 - BC024442.1 - AF047046.1 - AK003447.1 - AK151102.1 - AK159157.1 - AK152093.1 - AK152215.1 - AK152832.1 - AK150720.1

 
Come back to gene AK165946.1 - AK012218.1 - AK007594.1 - AK134364.1 - AK167422.1 - AK151559.1 - AK088707.1 - BC024442.1 - AF047046.1 - AK003447.1 - AK151102.1 - AK159157.1 - AK152093.1 - AK152215.1 - AK152832.1 - AK150720.1


For any suggestions or comments, please send an email to unitrap@crg.es