Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14579E7
Clone ID IST14579E7
Vector VICTR74
Project tigm

Sequence tag IST14579E7BBF1
Sequence
TTATAAATCTAGGGGATGCCGGCTGTGTGTCATAAACTTAAGATGTTAAAAAATAAAAAAACTAGGGAAACACCTTACGC
TGCATATAAAGCCACGGGAGAGGCCTTGGGCTGGCTGTGGGGAGGAAGGGGACAGCAGCGGCAGCGAAGGGAGCACGAGG
AGGAAGAGGAGACAACAAGGGCTGGATGTTATGGGTTGTGCACAGGGACTCTCCTTTGGTGATGGAATAGACCGACCTAT
GAAAACTCATTCTGCTTCACTCTTAAACATCTTCANNNTAANACTTCTCANTGAAAACATANCTCCAAGGTTTGCGTTGG
TTGTCAAATGTTATTCCTTTACCNGTGTACTANTAACATANAAAACAATCCTGTTTCTCAAGTTTGGCAATTTANATGTT
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97859565..97859964 380
 
EST/CDNA Est Name
  CX733968.1


Sequence tag IST14579E7HMR1
Sequence
ATAAAACTACAGACAGAATGAAGGTACTTAGGCAATATGAAAAAGTANAGCAGAAAAAAGATCTATCANTGTAATTTTCC
CTCTACTTACTGTTGCTGACTGCCAGTCC
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97859961..97860068 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]


Sequence tag IST14579E7HMF1
Sequence
TTATAAATCTAGGGGATGCCGGCTGTGTGTCATAAACTTAAGATGTTAAAAAATAAAAAAACTAGGGAAACACCTTACGC
TGCATATAAAGCCACGGGAGAGGCCTTGGGCTGGCTGTGGGGAGGAAGGGGACAGCAGCGGCAGCGAAGGGAGCACGAGG
AGGAAGAGGAGACAACAAGGGCTGGATGTTATGGGTTGTGCACAGGGACTCTCCTTTGGTGATGGAATAGACCGACCTAT
GAAAACTCATTCTGCTTCACTCTTAAACATCTTCAGAGTAAGACTTCTCAGTGAAAACATAACTCCAAGGTTTGCGTTGG
TTGTCAAATGTTATTCCTTTACCTGTGTACTATTAACATAAAAAACAATCCTGTTTCTCAAGTTTGGCNAATTTANATGT
TCTNNAATTCACAAGCACAAAANCACCNGGGAAAATACTATAAACTACAACTTATGAACAGTTTTACAACTAANCCAANT
TTTAATATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97859477..97859964 467
 
EST/CDNA Est Name
  CX733968.1

 
Come back to gene CX733968.1


For any suggestions or comments, please send an email to unitrap@crg.es