Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14388F6
Clone ID IST14388F6
Vector VICTR74
Project tigm

Sequence tag IST14388F6HMF1
Sequence
GTGCCCACAGAGATGTATTACACACGTGTTCCATAATAATGAATGAAAGACAGGCAGAGGTGGTGCACGCCTTTAATCCC
AGCACTTGGGAGGCAGAGGCAGGCAGATTTCTGAGTTTGAGGCCAGCCTGGTCCACAGAGAGGGCTCCAGGACAGCCAGT
GCTACACAGAGAAACCTGTCTCAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI30826

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104149526..104149724 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]


Sequence tag IST14388F6BBF1
Sequence
GTGCCCACAGAGATGTATTACACANNNGNTCCATAATAATGAATGAAAGACAGGCAGAGGTGGTGCACGCCTTTAATCCC
AGCACTTGGGAGGCAGAGGCAGGCAGATTTCTGAGTTTGAGGCCAGCCTGGTCCACAGAGAGGGCTCCAGGACAGCCAGT
GCTACACAGAGAAACCTGTCTCAAAAAAAAAAAAAAAAAANCCAAAA
Sequence Type genomic DNA
Unitrap ID UNI30826

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104149526..104149731 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es