Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14730C7
Clone ID IST14730C7
Vector VICTR76
Project tigm

Sequence tag IST14730C7HMR1
Sequence
ATATATATAAAATAATTCCAGTTTCAAGGGACCCAACACCCTCTGATGACATACACTCACACTGATATAGACACATATAC
AATGGATTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102183942..102184038 97
NO GENE  


Sequence tag IST14730C7BBF1
Sequence
ATATATGTGTGTGTGTGTGTGTGTGTGTGTGTATA
Sequence Type genomic DNA
Unitrap ID UNI22806 UNI33371 UNI36391 UNI36392 UNI36393 UNI36394

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7029573..7029607 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 11659232..11659266 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 39465314..39465348 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3728304..3728338 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071454 (Dtnb) NM_007886 dystrobrevin, beta Gene [Source:MGI Symbol;Acc:MGI:1203728]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 7555628..7555662 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 16218561..16218595 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045201 (Lrrc3b) NM_146052 leucine rich repeat containing 3B Gene [Source:MGI Symbol;Acc:MGI:2384996]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 17361248..17361282 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 25914461..25914495 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 6093940..6093974 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 13726030..13726064 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8872037..8872071 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071662 (Polr2g) NM_026329 polymerase (RNA) II (DNA directed) polypeptide G Gene [Source:MGI Symbol;Acc:MGI:1914960]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 13672827..13672861 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003418 (St8sia6) NM_145838 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6 Gene [Source:MGI (curated);Acc:St8sia6-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 11345625..11345659 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 10644557..10644591 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 15446276..15446310 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040118 (Cacna2d1) NM_009784 calcium channel, voltage-dependent, alpha2/delta subunit 1 Gene [Source:MGI Symbol;Acc:MGI:88295]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 10734373..10734407 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30609440..30609474 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 22164176..22164210 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22884726..22884760 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7420719..7420753 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031154 (Otud5) NM_138604 OTU domain containing 5 Gene [Source:MGI (curated);Acc:Otud5-003]

 
Come back to gene ENSMUSG00000031154


For any suggestions or comments, please send an email to unitrap@crg.es