Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10881E6
Clone ID IST10881E6
Vector VICTR76
Project tigm

Sequence tag IST10881E6HMR1
Sequence
NATAAAATCCCAACGAAGAGCAGGGTGTGGTGGCGCACACCTTTAATCTCANCACTCGGGAGGCAGAGGCAAGCGGATTT
CTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGAAACCCTGCCTCANAAAAA
AAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30730019..30730185 163
NO GENE  


Sequence tag IST10881E6BBF1
Sequence
ATTGCTGGTAAAAGACACCATGACCCGGCAGACATTTAACTGGGGCTGAGTTACAGTTTCNGAGGTGTAATCCATTATCA
TCATGGTGGGAAGCAGGGCAGTATGCCGGCAGACATGGTGCTGGAGTGGGCCGAGAGTTCTACATCTTCATCTGAAGGCA
NCAGGAGATTGTCTGCTGCAGGCAGCCAGTAAGAGGGTCGCTGGATCACATTAACCACACATAATCACATATATGAGATC
TG

Sequence Type genomic DNA
Unitrap ID UNI33340

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30729779..30730020 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059975 (Zfp74) NM_178384 zinc finger protein 72 Gene [Source:MGI (curated);Acc:Zfp74-003]

 
Come back to gene ENSMUSG00000059975


For any suggestions or comments, please send an email to unitrap@crg.es