Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR0275
Clone ID XR0275
Vector pGT0lxf
Project sanger

Sequence tag XR0275
Sequence
CTAGATGGTTTTTTTTGTACCCGAGAGACTGGAAGGCAAAGTCAAGCAGGAGCCCACCATGTATCGAGAGGGGCCTCCTT
ATCAGAGACGAGGCTCTCTGCAGATGTGGCAGTT
Sequence Type mRNA
Unitrap ID UNI3376

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22392819..22393078 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es