Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11296H2
Clone ID IST11296H2
Vector VICTR76
Project tigm

Sequence tag IST11296H2HMF1
Sequence
NGAGATGGCTCANCAGGTAAAAGCACTGACTGCCCTTCCCAAAGTCCTGAGTTCAAATCCCAGCAACCACATGGTGGCTC
ACAACCNTCCGTAATGAGATCTGATGCCCTCTTCTGGTGTGTCTGAANACAGCTACAGTGTACTTACNTATAATAATAAA
TAANTATTTAGCAGAGACATTCTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI10653

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 122660430..122660620 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000012396 (Nanog) NM_028016 Nanog homeobox Gene [Source:MGI (curated);Acc:Nanog-003]


Sequence tag IST11296H2BBF1
Sequence
TTGAGATGGCTCAACAGGTAAAAGCACTGACTGCCCTTCCCAAAGTCCTGAGTTCAAATCCCANCAACCACATGGTGGCT
CACAACCATCCGTAATGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI10653

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 122660429..122660531 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000012396 (Nanog) NM_028016 Nanog homeobox Gene [Source:MGI (curated);Acc:Nanog-003]

 
Come back to gene ENSMUSG00000012396


For any suggestions or comments, please send an email to unitrap@crg.es